Molekulare Klonierung und Epitop …

Molekulare Klonierung und Epitop …

Molekulare Klonierung und Epitop ...

Molekulare Klonierung und Epitop-Analyse der Erdnussallergen Ara h 3

1 Abteilung für Biochemie und Molekularbiologie, und 2 Department of Pediatrics, University of Arkansas for Medical Sciences, Arkansas-Kinderklinik Research Institute, Little Rock, Arkansas 72205, USA 3 Department of Pediatrics, der Mount Sinai Medical School, New York, New York 10029 , USA

Korrespondenzadresse: Gary A. Bannon, University of Arkansas for Medical Sciences, Slot 516, 4301 W. Markham, Little Rock, Arkansas 72205, USA. Telefon: (501) 686-5787; Fax: (501) 686-8169; E-mail: ude.smau.egnahcxe@ayragnonnaB

Empfangene 1998 28. September; Akzeptierte 1999 1. Januar.

Copyright &# X000a9; 1999 American Society for Clinical Investigation

Dieser Artikel wurde von anderen Artikeln in PMC zitiert.

Abstrakt

Erdnuss-Allergie ist eine signifikante IgE-vermittelten Gesundheitsproblem wegen der erhöhten Prävalenz, mögliche Schwere und Chronifizierung der Reaktion. Nach unserer Charakterisierung der beiden Erdnuss Allergenen Ara h 1 und Ara h 2 haben wir einen cDNA-Klon isoliert ein drittes Erdnussallergen kodiert, 3. Ara h Die abgeleitete Aminosäuresequenz von Ara h 3 zeigt Homologie zu 11S-Samenspeicherproteine. Die rekombinante Form dieses Protein wurde in einem bakteriellen System exprimiert und wurde durch Serum IgE erkannt aus &# X0223c; 45&# X00025; unserer Erdnuss-Allergie-Patientenpopulation. Serum IgE von Patienten und überlappenden, synthetischen Peptide wurden verwendet, um die lineare abzubilden, IgE-bindenden Epitope von Ara h 3. Vier Epitope, zwischen 10 und 15 Aminosäuren in Länge, innerhalb der Primärsequenz gefunden wurden, ohne offensichtliche Sequenzmotiv durch die Peptide geteilt. Ein Epitop wird von allen Ara h 3 anerkannt&# X02013; allergischen Patienten. Die Mutationsanalyse der Epitope zeigten, dass einzelne Aminosäureänderungen innerhalb dieser Peptide zu einer Reduktion oder Verlust der IgE-Bindung führen könnte. Durch die Bestimmung, welche Aminosäuren entscheidend für die IgE-Bindung, könnte es möglich sein, die Ara h 3 cDNA zu verändern, ein Protein zu codieren mit einer reduzierten IgE-Bindungskapazität. Diese Ergebnisse werden die Gestaltung von verbesserten diagnostischen und therapeutischen Ansätzen für die Nahrungsmittelüberempfindlichkeitsreaktionen ermöglichen.

Einführung

Erdnuss-Allergie ist ein großes Gesundheitsproblem wegen der Schwere der allergischen Reaktion, die Persistenz der allergischen Reaktion während der gesamten Lebensdauer des Individuums, und die allgegenwärtige Verwendung von Erdnuss als Proteinergänzung in verarbeiteten Lebensmitteln. Lebensmittel-Überempfindlichkeitsreaktionen beeinflussen &# X0223c; 8&# X00025; von Kindern und 1&# X00025;&# X02013; 2&# X00025; der Erwachsenen (1. 2). Erdnüsse, Nüsse und Schalentiere sind für die Mehrheit der Lebensmittel-Überempfindlichkeitsreaktionen bei Erwachsenen, während Erdnüsse, Milch und Eier für die Mehrzahl der Reaktionen bei Kindern ausmachen (3). Die Reaktion auf Erdnuss ist in der Regel schwerer als die Reaktion auf andere Lebensmittel, die oft in tödlichen Anaphylaxie führt. Obwohl die meisten Kinder Allergien auf Milch und Eier entwachsen, Erdnuss-Allergien bestehen bis ins Erwachsenenalter, die gesamte Lebensdauer des Individuums nachhaltig (4). Derzeit Vermeidung ist die einzige Behandlung für Patienten mit Erdnussallergie. Leider macht die Aufnahme von Erdnuss als Proteinergänzung in verarbeiteten Lebensmitteln zufälligen Verbrauch fast unvermeidlich. Trotz der Prävalenz von Erdnuss Überempfindlichkeit bei Kindern und einer steigenden Zahl von Todesfällen pro Jahr aus Erdnuss-induzierten Anaphylaxie, die Identifizierung und Charakterisierung von einzigartigen, klinisch relevante Allergene aus Erdnuss sind unvollständig, zu begrenzen unser Verständnis für ihre Rolle in der Immunbiologie von Überempfindlichkeitsreaktionen.

Die Exposition gegenüber einem Allergen induziert die Produktion von Allergen-spezifischen IgE-Antikörper und die nachfolgende Entwicklung einer allergischen Reaktion bei atopischen Individuen (5). In den letzten Jahren wurden eine Reihe von Allergenen identifiziert, die IgE-Produktion zu stimulieren und verursachen IgE-vermittelte Krankheit (6 &# X02013; 9). Obwohl umfangreiche Informationen über die Kennzeichnung vorhanden, Reinigung und Klonierung von inhalativen Allergene (Pollen, Hausstaubmilben, Tierhautschuppen, Insekten und Pilze), nur wenige Nahrungsmittelallergene identifiziert und untersucht worden.

Die Erdnuss (Prunus dulcis ) Ist ein Mitglied der Leguminosen (Fabaceae) Familie, die die Sojabohne, Jackbohne, Limabohne und Erbse (10). Peanut teilt viele kreuzreagierenden Proteine ​​mit diesen anderen Mitgliedern; jedoch Einnahme dieser anderen Leguminosen entlockt selten eine klinische Reaktion in Erdnuss-Allergie-Patienten (11). Um allergenen Proteine ​​einzigartig für die Erdnuss identifizieren, kreuzreagierenden Antikörper gegen Sojabohnen wurden aus den Seren von Erdnuss-Allergie-Patienten entfernt. Diese Soja-adsorbierten Seren, mit IgE-Antikörpern eindeutig Erdnuss, mehrere allergene Fraktionen auf Immunoblots ganze Erdnuss-Protein (12) identifiziert. Zwei dieser Fraktionen, Ara h 1 (63,5 kDa) und Ara h 2 (17 kDa) wurden in unserem Labor ausgiebig charakterisiert. Diese Proteine ​​wurden isoliert, und ihre entsprechenden cDNA wurde aus einer cDNA-Bibliothek mature Erdnuß kloniert (13. 14). Beide Proteine ​​werden durch Serum IgE erkannt aus &# X0003e; 90&# X00025; von Erdnuss-Allergie-Patienten, so dass sie als Haupt Erdnuss-Allergene zu etablieren. Serum IgE Erkennung dieser Allergene erscheint in erster Linie auf sein, den Aminosäuren, umfassend lineare Epitope in Abwesenheit von Kohlenhydraten (14. 15). Die Mutationsanalyse dieser immuno-Epitope hat ergeben, dass IgE-Bindung kann durch einzelne Aminosäure-Mutationen innerhalb jedes Epitop (14. 15) abgeschafft werden. Diese Ergebnisse zeigen, dass rekombinantes Protein kann für die Verwendung in beiden diagnostischen und immuntherapeutische Ansätze zu Erdnuß Überempfindlichkeits betrachtet werden.

In diesem Artikel berichten wir über die Klonierung der cDNA ein drittes Erdnussallergen kodiert, Ara h 3. Sequenzierung des Ara h 3 cDNA dieses Allergens als Legumin artigen Samenspeicherprotein identifiziert. Die rekombinante Form dieses Proteins wurde in einem bakteriellen System exprimiert und wird von Serum-IgE aus 44 erkannt&# X00025; (8/18) unserer Erdnuss-hypersensiblen Patientenpopulation. Die abgeleitete Aminosäuresequenz wurde verwendet, bei der Durchführung einer detaillierten Analyse der linearen IgE-bindenden Epitope dieses Proteins synthetische Peptide zur Verwendung zu konstruieren. Diese Ergebnisse werden die Gestaltung von verbesserten diagnostischen und therapeutischen Ansätze ermöglichen Menschen mit Erdnuss-Überempfindlichkeit zu behandeln.

Methoden

Patienten.

Serum von Patienten mit dokumentierter Erdnuss Überempfindlichkeit wurde verwendet, um rekombinantes Protein zu Sonde und der Ara h 3 IgE-bindenden Epitope zu identifizieren. Jeder Patient hatte eine positive sofortige Haut-Prick-Test auf Erdnüsse und entweder eine positive doppelblinden, placebokontrollierten Nahrungsmittelproblem oder eine überzeugende Geschichte von Erdnuss Anaphylaxie (Larynxödem, schwere Atemnot und / oder Hypotonie). Ein Individuum mit erhöhten Serum-IgE-Spiegel diente als Kontrolle in diesen Studien (die nicht Erdnuss-spezifischen IgE oder zeigen Erdnussüberempfindlichkeit). In einigen Fällen kann ein Serumpool, bestehend aus gleichen Aliquots von Serum IgE von jedem der Patienten wurde in Immunblot-Analyse-Experimente verwendet, um die IgE-Bindungseigenschaften der Population zu bestimmen. Einzelheiten umreißt die Herausforderung Verfahren und Sammlung von IgE-Serum wurden zuvor diskutiert worden (16). Alle Untersuchungen wurden von der Human Use Advisory Committee an der University of Arkansas for Medical Sciences genehmigt.

Isolierung und Aminosäuresequenzanalyse von Erdnussallergen Ara h 3.

Gelstücke enthaltenden Ara h 3 wurden dem W.M. geschickt Keck Foundation (Biotechnologie Ressourcen Laboratory, Yale University, New Haven, Connecticut, USA) für die Aminosäuresequenzierung. Das NH2 -terminale Aminosäuresequenz von Ara h 3 wurde durch Durchführen einer Edman-Abbau auf einem Applied Biosystems Inc. (Foster City, Kalifornien, USA) Gasphasen-Sequenzer mit einem Online-HPLC-Säule bestimmt, die mit steigenden Konzentrationen von Acetonitril eluiert wurde.

Identifizierung von Ara h 3 cDNA-Klone.

Eine reife Erdnuss-cDNA-Bibliothek wurde mit einem abgeschirmten &# X003b3; -ATP, 5&# X02032; endmarkiert, degeneriert 23-bp-Oligonukleotid aus dem NH abgeleitet2 -terminale Aminosäuresequenz (ISFRQQPEENA). Positive Plaques wurden einer in vivo Exzision Phagemid aus dem Vektor unter Verwendung der R408-Helferphage (Stratagene, La Jolla, Kalifornien, USA) nach einem Protokoll des Herstellers zu entfernen. Die Überstände der exzidierten Phagemid pBluescript verpackt als filamentöse Phagenpartikel enthalten, wurden in sterile Röhrchen dekantiert. Für DNA-Präparation wurden gerettet Phagemide auf LB-Ampicillin-Platten ausplattiert XL-1 Blue-Zellen verwendet und über Nacht bei 37 inkubiert&# X000b0; C. Kolonien auf der Platte erscheinen, enthalten den pBluescript doppelsträngigen Plasmid mit dem klonierten Insert. DNA wurde unter Verwendung des Plasmid Spin Miniprep Kit vorbereitet (QIAGEN Inc. Valencia, Kalifornien, USA) und sequenziert, wie später beschrieben. Mehrere Klone wurden auf diese Weise alle identifiziert fehlten &# X0223c; 300 bp des 5&# X02032; Ende.

Amplifikation von Glycinins cDNA-Enden.

Die CapFinder PCR cDNA Library Construction Kit (CLONTECH Laboratories Inc. Palo Alto, Kalifornien, USA) wurde verwendet, um die 5 selektiv zu verstärken,&# X02032; Abschnitt der cDNA-Codierung Ara h 3 Poly (A) &# X0002b; RNA wurde wie beschrieben isoliert zuvor (13). Zur Erststrang-cDNA-Synthese, 0,5 &# X003bc; g Poly (A) &# X0002b; RNA, 1 &# X003bc; l Oligonukleotid Capswitch, 5 pmol 3FA.S. (GCACCTTCTGGTGACTATC), ein Primer-Antisense von einer konservierten Nukleotidsequenz in Glycinine abgeleitet wurden bei 72 inkubiert&# X000b0; C für 2 min, dann 2 min auf Eis gestellt, bevor zu einem Gemisch von 5 hinzugefügt wird&# X000d7; Erststrang- Puffer, 2 mM DTT, 1 mM dNTP und 100 U Moloney-Maus-Reverse-Transkriptase-Leukämie-Virus. Diese Reaktion erfolgte bei 42&# X000b0; C für 1 h und wurde auf Eis gestellt. Zur Verstärkung cDNA doppelsträngige, 2 &# X003bc; l Erststrang-cDNA und 5 pmol von jeweils 3FA.S. und H1 (als Primer dienen) wurden hinzugefügt, um ein Reaktionsgemisch, enthaltend 1&# X000d7; KlenTaq PCR-Puffer, 0,2 mM dNTP, 1&# X000d7; KlenTaq Polymerase Mix und dH2 O. Die PCR-Reaktion begann mit einem 1 min Denaturierung bei 95&# X000b0; C, gefolgt von 22 Zyklen Denaturierung bei 95&# X000b0; C und Annealing / Verlängerung für 5 min bei 68&# X000b0; C. Das amplifizierte 5&# X02032; Teil des Ara h 3 cDNA wurde von Promega Corp. (Madison, Wisconsin, USA) nach Standardprotokollen geliefert in einen pGEM-T-Vektor kloniert.

PCR-Amplifikation der Ara h 3-mRNA-Sequenz.

Zwei Oligonukleotide &# X02014; Rab-1 (CGNCAGCAACCGGAGGAGAACGC), von der Nucleotidsequenz abgeleitet von selektiven Amplifikation der 5 erhalten&# X02032; Ende der Erdnuss Glycinine und T7&# X0002b; (CGACTCACTATAGGGCGAATTGG), ein Oligonukleotid aus dem Vektor pBluescript-Sequenz abgeleiteten &# X02014; Codieren der Ara h 3-Protein diente als Primer für eine PCR-Reaktion, um die Nukleotidsequenz selektiv zu verstärken. Unsere reifen Erdnuss-cDNA-Bibliothek diente als Vorlage und wurde von Standard-Phenol / Chloroform-Extraktion durch Ethanolfällung konzentriert, gefolgt. Jede PCR-Reaktion bestand aus 1 &# X003bc; l konzentrierte cDNA-Bibliothek, 5 pmol von jedem Primer, 0,2 mM dNTP und 1,25 U von Taq DNA-Polymerase. Diese Reaktionen wurden in einem Puffer, der 3 mM MgCl durchgeführt2. 500 mM KCl und 100 mM Tris-HCl (pH 9,0). Nach einer anfänglichen Denaturierung Zyklus bei 94&# X000b0; C für 2 min, 30 Zyklen von PCR, bestehend aus einer 30-s Denaturierungsschritt bei 94&# X000b0; C, gefolgt von Tempern bei 60&# X000b0; C für 30 s und Verlängerung bei 72&# X000b0; C für 1 min wurden in einem Thermocycler (Perkin-Elmer Corp. Norwalk, Connecticut, USA) durchgeführt. Nachdem er auf eine 1 durch Elektrophorese zu trennen&# X00025; Agarose-Gel und Reinigung, Produkte der geeigneten Größe wurden in einen pGEM-T-Vektor inseriert.

DNA-Sequenzierung und Analyse.

Die Sequenzierung wurde nach den Methoden von Sanger durchgeführt, et al. (17) unter Verwendung von Oligonukleotidprimern auf unterschiedliche Bereiche des Klons gerichtet und dem Femtomol DNA Cycle Sequencing-System (Promega Corp.). Die Sequenzanalyse wurde an der University of Arkansas for Medical Science VAX geführt, um die Wisconsin DNA-Analyse-Software-Paket mit (18).

Bakterielle Expression und Reinigung von rekombinantem Ara h 3.

Eine cDNA in die Ara h 3-Sequenz entspricht, wurde durch PCR amplifiziert und in einen pET Vektor kloniert. Dieses Plasmid erlaubt die Expression eines rekombinanten Proteins, das die Zugabe von Ala Ser 1. 2. Phe und 3 am NH enthalten2 -Terminus, drei Aminosäuren nicht durch unsere Klon codiert. Ser 2 und 3 Phe fallen zusammen mit den Aminosäuren in dem nativen Protein; jedoch Ile 1 in dem nativen Protein wurde zu Ala verändert 1 in dem rekombinanten zur Vereinfachung der Ausdruck (19). Primer für die PCR wurden entwickelt, um eine zu schließen NHE I-Stelle am 5&# X02032; Ende der cDNA und Sal I-Stelle am 3&# X02032; Ende der cDNA. Die verwendeten Primer waren 5&# X02032; -TATGGCTAGCTTCCGGCAGCAACCGGAGGAG-3&# X02032; (5&# X02032; Primer) und 5&# X02032; -CCGTCGACAGCCACAGCCCTCGGAGA-3&# X02032; (3&# X02032; Grundierung). PCR-Produkte wurden in das klonierte NHE ICH/ Sal I-Restriktionsstellen des Plasmids pET 24 (B) &# X0002b; unter der Kontrolle des T7-lac-Promotor. Dieser Expressionsvektor enthält die codierende Gen Kanamycinresistenz und codierende Sequenz für ein His6 Tag am COOH-Terminus des rekombinanten Proteins produziert. Protein-Expression in der Escherichia coli Stamm BL21 (DE3) wurde durch Zugabe von Isopropyl- induziertenB — D -thiogalactopyranoside bis zu einer Endkonzentration von 1 mM, sobald die Kultur eine erreicht600 &# X0003d; 0,6. Die Zellen wurden in 1-stündigen Intervallen geerntet, in SDS-Probenpuffer DTT enthielt, resuspendiert und bei 100 gekocht&# X000b0; C für 5 min. Proben wurden entweder sofort für die Immunoblot-Analyse verwendet werden, oder Proben wurden pelletiert, mit 50 mM Tris-HCl gewaschen und für die spätere Verwendung als gefrorenes Pellet gelagert bei &# X02013; 70&# X000b0; C.

Rekombinante Ara h 3 wurde aus bakteriellen Lysaten unter denaturierenden Bedingungen gereinigt, um das His-Bind-Reinigung unter Verwendung von Kit (Novagen Inc. Madison, Wisconsin, USA). Zellextrakte wurden in 4 ml kaltem Bindungspuffer (5 mM Imidazol, 0,5 M NaCl, 20 mM Tris-HCl und 6 M Harnstoff, zugeführt mit Novagen kit) resuspendiert, beschallt DNA zu scheren, und für 1 h auf Eis inkubiert. Als nächstes wurde das Lysat bei 12000 zentrifugiert G für 45 min um Zelltrümmer zu entfernen. Der Überstand wurde postcentrifugation zum Laden auf die Säule hergestellt, indem man es durch ein 0,45- Passieren&# X003bc; m-Membran mit einer Spritze-End-Filter. Eine His-Bind Schnell Säule (Novagen) wurde mit entionisiertem H mit His-Bind Metallchelatisierung Harz, gewaschen verpackt2 O, und bis zur Sättigung mit Ladepuffer (50 mM NiSO geladen4 ; Novagen). Nach Äquilibrierung der Säule mit Bindungspuffer, 2 Volumen Überstand wurden auf die Säule geladen. Die Säule wurde mit 10 Volumen Bindungspuffer und 6 Volumina Waschpuffer (20 mM Imidazol, 0,5 M NaCl, 20 mM Tris-HCl und 6 M Harnstoff) gewaschen. Elution wurde mit 5 Volumen Elutionspuffer (1 M Imidazol, 0,5 M NaCl, 20 mM Tris-HCl und 6 M Harnstoff; Novagen) erreicht. Fraktionen im Verlauf des Experiments gesammelt rekombinanten Ara h 3 enthielten, wurden lyophilisiert und gelagert in 1&# X000d7; PBS.

SDS-PAGE, Western-Blots und IgE-Bindungstest.

Gereinigtes rekombinantes Ara h 3 wurde durch SDS-PAGE unter Verwendung von vorgegossenen 12 analysiert&# X00025; Tris-Glycin-Gelen (Novex, San Diego, California, USA). Die Proben wurden für 90 min bei 125 V. Die Proteine ​​elektrophoretisch entweder durch Coomassie-Blau-Färbung sichtbar gemacht wurden oder durch Verwendung Gelcode Blau Stain Reagent (Pierce Chemical Co. Rockford, Illinois, USA) nach dem Protokoll des Herstellers. Für Immunoblot-Analyse wurden die Proteine ​​auf Nitrocellulose durch Elektroblotting bei 30 V für 90 min. unter Verwendung einer Lösung mit Tris-NaCl und 3 Nach dem Transfer wurden die Blots blockiert&# X00025; BSA. Alternativ Cellulosemembranen synthetische Peptide enthielten, wurden in einer Lösung zur Verfügung gestellt von Genosys Biotechnologies, Inc. (The Woodlands, Texas, USA) blockiert. Alle Blots wurden mit einem Serumpool von Patienten mit dokumentierter Erdnuß Überempfindlichkeit oder individuellen Seren inkubiert, verdünnt (1: 5) in einer Lösung, die Tris-NaCl und 1&# X00025; BSA für 16 h bei 4&# X000b0; C. Primäre Antikörper wurde mit 125 I-markiertem anti-IgE-Antikörper (Sanofi Diagnostics Pasteur Inc. Paris, Frankreich) nachgewiesen.

Die Peptidsynthese.

Einzelne Peptide wurden mit Fluorenylmethoxycarbonyl (Fmoc) Aminosäuren auf einem derivatisierten Cellulosemembran mit freien Hydroxylgruppen synthetisiert gemß den Anweisungen des Herstellers (Genosys Biotechnologies). Kurz gesagt, die Synthese eines jeden Peptids begann eine Fmoc-Aminosäure an die Cellulosemembran durch Verestern. Kopplungsreaktionen werden durch Acetylierung mit Essigsäureanhydrid in N ,N -Dimethylformamid Peptide zu machen während der nachfolgenden Schritte nicht reaktiv. Nach der Acetylierung werden Fmoc-Schutzgruppen durch die Zugabe von Piperidin entfernt naszierenden Peptide reaktiv machen. Die verbleibenden Aminosäuren werden durch denselben Prozess der Kupplungs, Sperrung und Entschützung hinzugefügt, bis das gewünschte Peptid erzeugt wird. : 1: 0,05-Gemisch von Dichlormethan / trifluoreacetic Säure / trilisobutylsilane und mit Methanol gewaschen Nach Zugabe der letzten Aminosäure sind die Seitenketten des Peptids mit einer 1 entschützt. Die Membranen synthetische Peptide enthielten, wurden entweder sofort mit Serum IgE oder gespeichert sondiert bei &# X02013; 20&# X000b0; C bis benötigt.

Ergebnisse

Molekulare Klonierung und Sequenz der Ara h 3 cDNA.

Das NH2 -Terminus eines gereinigten Protein 14-kDa von Soja-adsorbierte IgE Serum von Erdnuss-hypersensitiven Patienten wurde für die Aminosäuresequenzierung (12) identifiziert verwendet. Degenerierten Oligonukleotiden, die von der Aminosäuresequenz abgeleitet wurden verwendet, um eine reife Erdnuß cDNA-Bibliothek zu screenen. Genauere Angaben über die verwendeten Verfahren zur Ara h 3-cDNA zu klonen sind in Methoden beschrieben. Die Sequenz der Ara h 3-cDNA und die abgeleitete Aminosäuresequenz sind in Fig. &# X200B; Fig. 1. 1. Die Ara h 3-cDNA ist ein Open-Leserahmen von 1.530 Nukleotiden, Codierung für 510 Aminosäuren. Dieser Leserahmen beginnt mit einem Codon CGG und endet mit einem TAA Stop-Codon bei Nukleotidposition 1533. Die berechnete Grße des Proteins, das durch dieses offene Leseraster codiert ist &# X0223c; 57 kDa. Die 24 Aminosäuren vom NH erhalten2 -terminale Sequenzierung des 14-kDa-Protein entsprechen den Amino- von den Nukleotiden an der 5 befindet codierten Säuren&# X02032; Ende des cDNA-Klons. Das 14-kDa-Protein scheint ein NH sein2 -Terminal Abbauprodukt eines größeren Allergen. Dieser cDNA-Klon scheint die extreme 5 zu fehlen&# X02032; Ende, das ein Signalpeptid und den Initiator Methionin kodieren würde. Datenbank sucht nach Sequenzähnlichkeit ergab, dass die Ara h 3 cDNA codiert ein 11S Samenspeicherprotein. Ara h 3 zeigten 62&# X00025;&# X02013; 72&# X00025; Sequenzidentität zu Glycinine aus Glycine max (Soja) und Legumine aus Pisum satvium (Erbse). Insbesondere 24 von 26 Resten gedacht für die Tertiärstruktur dieser Speicherproteine ​​wichtig zu sein (20) vorhanden sind, in die Ara h 3 Primärsequenz, einschließlich einem konservierten Spaltstelle an Asn-325 und Gly-326. Es gab keine Homologie zwischen diesem Allergen und den anderen großen Erdnuss-Allergene bereits identifiziert (Ara h 1 oder Ara h 2) zur Kenntnis genommen.

Nucleotid-Sequenz eines Ara h 3-cDNA-Klon. Die Nucleotidsequenz ist in der zweiten Zeile. Die erste Zeile ist die abgeleitete Aminosäuresequenz. Geschachtelt Aminosäuren entsprechen der Aminosäuresequenz aus dem NH bestimmt2 -Terminus des Ara h 3-Protein. .

Expression, Antigenität und Reinigung von rekombinantem Ara h 3.

Die Ara h 3-cDNA wurde in einen pET 24-Plasmid kloniert und in einem bakteriellen System exprimiert. Optimale Expression wurde gewonnen wurden vier Stunden Induktion durch isopropyl B- D -thiogalactopyranoside (Fig. &# X200B; (Abb.2 2 ein. Fahrbahn F ). Der Immunoblot in Fig. &# X200B; Abb.2 2 b Verwendung von Serum IgE aus einem Pool von Patienten mit Erdnussüberempfindlichkeits wurde durchgeführt, um das Molekulargewicht und Spezifität von IgE-Bindung zu bestimmen. Von dem Blot, ist die geschätzte Größe des rekombinanten Proteins durch Bakterienzellen erzeugt &# X0223c; 57 kDa, die mit der vorhergesagten Molekülmasse entspricht, durch den Klon codiert wird. Zahl &# X200B; Abbildung 2 2 c zeigt 20 Immunblotstreifen von rekombinantem Ara h 3 mit unterschiedlichen Patientenserum inkubiert. Vierundvierzig Prozent (8/18) der getesteten Patienten hatten IgE, dass das rekombinante Protein (Fig erkannt. &# X200B; (Abb.2 2 c. Bahnen EIN &# X02013;R ). Der Unterschied in der Bindungsstärken zwischen Ara h 3&# X02013; allergischen Patienten könnte durch die Menge an Erdnussspezifischen IgE in jedem einzelnen oder Unterschiede in der Affinität des Patienten-spezifischen IgE zu diesem Allergen.

Bakterielle Expression und Immunoblot-Analyse von rekombinantem Ara h 3 (ein ) 10-&# X003bc; l Proben Bakterienextrakt wurden in einem 12 elektrophoretisiert&# X00025; Tris-Glycin-Gel. Proteine ​​wurden durch Coomassie-Blau-Färbung sichtbar gemacht. Fahrbahn EIN. 4-h Induktion von Vektor .

Mehrere IgE-bindenden Regionen der Ara h 3-Protein befindet.

Dreiundsechzig überlappende Peptide synthetisiert, auf die Proteinbereiche des Ara h 3 bestimmen wurden von Serum IgE erkannt. Jedes Peptid wurde synthetisiert, 15 Aminosäuren lang und aus dem vorherigen Peptid durch acht Aminosäuren ausgeglichen. Dieser Ansatz erlaubt die Analyse des gesamten Ara h 3 Primärsequenz in großen, sich überlappenden Fragmenten. Diese Peptide wurden mit einem Serumpool von IgE von Erdnuss-hypersensitiven Patienten sondiert, die zuvor gezeigt worden war, rekombinante Ara h 3. Abbildung zu erkennen &# X200B; 3 zeigt die vier figure3 IgE-Bindungsregionen und deren entsprechende Position innerhalb des Ara h 3 primäre Aminosäuresequenz. Diese IgE-Bindungsregionen wurden durch Aminosäurereste 21 dargestellt&# X02013; 55, 134&# X02013; 154, 231&# X02013; 269 und 271&# X02013; 328.

Mehrere IgE-Bindungsregionen auf der Ara h 3 Allergen identifiziert. (ein ) Wurde die Ara h 3 Primärsequenz als 15 Aminosäuren synthetisiert&# X02013; lange Peptide voneinander versetzt um acht Resten. Diese Peptide wurden mit einem Pool von Serum-IgE aus sondiert .

Um die genaue Aminosäuresequenz der IgE-Bindungsregionen, synthetische Peptide (15 Aminosäuren ausgeglichen durch zwei Aminosäuren), die die größere IgE-Bindungsregionen bestimmen, wurden mit einem Serumpool von IgE von Patienten erzeugt und untersucht, die rekombinante Ara h erkennen 3. Dieses Verfahren ermöglichte es, einzelne IgE-bindenden Epitope innerhalb der größeren IgE-Bindungsregionen des Ara h 3-Proteins zu unterscheiden. Zahl &# X200B; Abbildung 4 4 ein ist ein Immunoblot von sechs synthetische Peptide, während Fig. &# X200B; Bild 4 4 b Diese Region und die Aminosäuresequenzen zeigt die Aminosäuresequenz von jedem einzelnen Peptid, dargestellt darstellt. Der schraffierte Bereich in Fig. &# X200B; Bild 4 4 b stellt den Kern Epitop. Die vier IgE-bindenden Epitope, die auf diese Weise identifiziert sind in Tabelle &# X200B; Table1, 1. with the epitopes ranging from nine to 13 amino acids in length.

Identifikation eines Kern IgE-bindenden Epitop auf dem Ara h 3 Allergen. (ein ) Ausführliches Epitopkartierung wurde durch Synthese überlappender Peptide, 15 Aminosäuren in der Länge von dem vorherigen Peptid durch zwei Reste Offset auf IgE-Bindungsregionen durchgeführt. Diese .

Ara h 3 IgE-Bindungsepitope

Immunodominanz und Charakterisierung des Ara h 3-Epitope.

Um zu bestimmen, ob irgendwelche der vier Epitope immunodominant waren (innerhalb des Ara h 3&# X02013; allergische Bevölkerung), wobei jeder Satz von vier Peptide wurde einzeln mit Serum IgE aus den acht Patienten sondiert zuvor in der Tabelle gezeigt, zusammengefasst rekombinante Ara h 3 (Ergebnisse erkennen &# X200B; Tabelle 1 1 als Prozentsatz Erkennung). Epitope 1 wurde von 25 durch Serum IgE erkannt&# X00025; (2/8) der getesteten Patienten, während Epitope 2 und 4 wurden aus 38 durch Serum IgE erkannt&# X00025; (3/8) der acht getesteten Patienten. Interessanterweise Epitope 2 und 4 wurden mit den gleichen drei Patienten anerkannt. Epitops 3 wurde aus 100 durch Serum IgE erkannt&# X00025; (8/8) des Ara h 3&# X02013, allergische Patienten, die Klassifizierung als ein immuno-dominante Epitope innerhalb der Ara h 3&# X02013, allergische Bevölkerung. Achtundsechzig Prozent der Aminosäuren bildet, die Epitope wurden entweder polar ungeladen oder apolaren Resten. Jedoch gab es keine offensichtliche Sequenzmotiv in Bezug auf die Position oder die Polarität der einzelnen Epitope geteilt.

Mutationen an spezifischen Resten beseitigen IgE-Bindung.

Die Aminosäuren essentiell für IgE-Bindung an die Ara h 3-Epitope durch Synthetisieren mehrerer Peptide mit einzelnen Aminosäureänderungen an jeder Position bestimmt. Diese Peptide wurden mit einem Pool von Serum IgE von Patienten untersucht, die zuvor erkannt hatte, die Wildtyp-Peptid, um zu bestimmen, ob Änderungen Aminosäure betroffen Erdnuss-spezifischen IgE-Bindung. Feige. &# X200B; 5 5 zeigt einen Immunoblot Streifen das Wildtyp und Mutante Peptide für Epitop 4. Der Pool von Serum-IgE enthält nicht das Peptid erkennen, oder eine Abnahme der Bindung wurde beobachtet, wenn Alanin für die Wildtyp-Aminosäure ersetzt wurde Positionen 308, 309, 310, 311, 312 und 314. Interessanterweise scheint es, als ob eine Alanin-Substitution IgE-Bindung an den Positionen 304 und 305. die verbleibenden Ara h 3-Epitope in der gleichen Weise erhöht wurden analysiert. Im allgemeinen könnte jedes Epitops zu einem nicht verändert werden,&# X02013; IgE-bindendes Peptid, das durch den Ersatz des Wildtyp-Aminosäurerest mit Alanin. Die kritischen Reste für die IgE-Bindung innerhalb jedes Ara h 3-Epitops in der Tabelle gezeigt sind, &# X200B; Tabelle 2. 2. Es scheint, dass die zentralen Aminosäuren innerhalb jedes Epitops für die Mutation begünstigt. Alle Mutationen, die zu einer signifikanten Abnahme der IgE-Bindung geführt wurden an den Resten innerhalb jedes Kernepitop gefunden befindet (wie in Fig identifiziert. &# X200B; 4). 4). Es gab keine offensichtliche Consensus in der Art der Aminosäure, die, wenn zu Alanin mutiert führt Verlust zu vervollständigen oder zu einer Abnahme der IgE-Bindung.

Ara h 3-Epitope können an nicht mutiert werden,&# X02013; IgE-bindenden Peptide. Epitops 4 wurde durch einen Alaninrest für eine der Aminosäuren an jeder Position in dem Peptid substituiert synthetisiert. Die synthetisierten Peptide wurden mit einem Pool von Serum IgE sondiert .

Aminosäuren entscheidend für die IgE-Bindung

Diskussion

Wir haben die cDNA-Klonierung, Expression und Epitop-Analyse von Ara h 3 ist ein allergenes, 11S Speicherprotein aus der Erdnuß berichtet, A. hypogaea. Obwohl diese vorherrschende Proteine ​​in Leguminosen sind, ist dies das erste Mal, dass die cDNA von einem 11S-Speicherprotein kloniert wurde und ein allergenes Protein in der Erdnuß kodieren gezeigt. 11S Speicherproteine ​​werden zunächst als 60-kDa preproglobulins synthetisiert bestehend aus sauren und basischen Polypeptide kovalent verknüpft. Die Vorläufer sind in Lagerkörpern abgelagert, wo sie in Trimeren aggregiert, bevor sie von einem Asparagin-abhängige Endopeptidase gespalten werden (21 22). Dies führt zu einer NH2 -terminale saure Kette &# X0223c; 35 kDa und eine COOH-terminalen Grundkette &# X0223c; 20 kDa, die später durch eine Disulfid-Brücke verbunden werden (23). 11S Speicherproteine ​​werden dann in ihre reife Form als Hexamer Oligomeren zusammengesetzt aus sechs ähnlichen Untereinheiten (24). Die Ara h 3 cDNA stellt die codierende Region für das 60-kDa preproglobulin.

Wir haben High-Level-Expression von rekombinantem Ara h 3 in einem bakteriellen System demonstriert. Serum IgE von 44&# X00025; (8/18) der Erdnuß-allergic Patientenpopulation erkannt rekombinante Ara h 3, es als Neben allergen Bezeichnen. Dies steht im Gegensatz zu den anderen Allergenen Erdnuß, Ara h 1 und Ara h 2, die beide Hauptallergene (25), erkannt durch &# X0003e; 90&# X00025; der Patientenpopulation. Alle drei dieser Allergene teilen ähnliche funktionelle Eigenschaften; sie sind alle Samen-Speicherproteine ​​ohne enzymatische Aktivität. Es besteht jedoch keine direkten Beweise dafür, warum nur ein Teil der Patientenpopulation erkennt Ara h 3. Die Fähigkeit von 11S Speicherproteine ​​in Hexameren und die Position der Epitope auf der Tertiärstufe der Proteinstruktur zu oligomerisieren kann Einblick in dieses Thema liefern . Eine andere Möglichkeit ist der Grad der Sequenzähnlichkeit zwischen diesen Proteinen aus verschiedenen Leguminosen beibehalten. Ara h 3 weist eine höhere Sequenzidentität mit Leguminosen Speicherproteine ​​aus Soja und Erbsen (62&# X00025;&# X02013; 72&# X00025;) als Ara h 1 weist mit vicilins (40&# X00025;) oder Ara h 2 Exponate mit conglutinins (39&# X00025;) (14. 15). Der Anteil der Patienten mit allergenspezifische IgE kann auf einzigartige Sequenzen hängen nicht von Proteinfamilien verschiedener Leguminosen-Spezies konserviert. Diese für den geringeren Anteil an Erdnuß-allergischen Patienten mit IgE auf Ara h 3 erklären würde und der kleineren Anzahl von linearen, IgE-Bindungsregionen innerhalb dieses Allergen gefunden. Mehrere Merkmale wurden zu rechtfertigen vorgeschlagen, warum bestimmte Proteine ​​allergen sind. Diese Gründe umfassen ihre erhöhte Fluss in der Lebensmittelversorgung, ihre Haltbarkeit während der Lebensmittelverarbeitung (Blanchieren) und ihre Beständigkeit gegenüber Verdauung im Magen-Darm-Trakts (26. 27). Ob diese Eigenschaften eine Rolle in, warum gerade dieser Protein ist ein weniger Allergen spielen muss noch untersucht werden.

Da die allergenspezifische IgE spielt eine so wichtige Rolle bei der Entstehung von allergischen Erkrankungen, die Bestimmung von Allergen-spezifischen IgE-bindenden Epitope ist ein wichtiger erster Schritt in Richtung auf das Verständnis der Komplexität von Überempfindlichkeitsreaktionen. Durch synthetische Generierung überlappender Peptide, die die gesamte Primärsequenz des Proteins darstellt, konnten wir feststellen, daß es vier unterschiedliche IgE-Erkennungsstellen in der gesamten Primärsequenz des Proteins verteilt sind. Einer dieser Standorte (Epitop 3) 3 wurde durch Serum IgE von jedem Ara h anerkannt&# X02013, allergische Patienten, wird es als immuno-dominante Epitope bezeichnen. Interessanterweise Epitope 3 und 4 innerhalb der hypervariablen Region des sauren Kette angeordnet sind, einen Abschnitt von Aminosäuren, die unter 11S Speicherproteine ​​sehr variabel in der Länge ist. Diese Region enthält einen hohen Anteil an Glutamat, Aspartat und Argininresten und tolerieren großen natürlich vorkommenden Insertionen oder Deletionen. Computervorhersagen von anderen Studien legen nahe, dass diese Region an der Oberfläche des Proteins exponiert ist (28), so dass es zugänglich IgE binden. Mehrere IgE-bindenden Epitope wurden für Allergene aus Kuhmilch (29), Dorsch (30), Hasel (31), Soja (32), Garnelen (33) und andere identifiziert. Die Beobachtung von mehreren IgE-Bindungsstellen spiegelt wahrscheinlich die polyklonale Natur der Immunantwort und kann beim Aufbau eines Protein als Allergen ein notwendiger Schritt. Auch die Vernetzung von IgE auf der Oberfläche des Allergens für Mastzellen-Degranulation erforderlich, auf die Freisetzung von Histamin und anderen Mediatoren der Immunantwort führt. Zur Vernetzung stattfindet, mehrere IgE-Bindungsstellen müssten vorhanden sein.

Soybean Glycinine sind seit langem das Ziel von genetischen Studien Engineering richtet auf ihren Nährwert zu verbessern (34 &# X02013; 37). Anfängliche Experimente zeigten, dass Mutationen innerhalb der 35-kDa-Untereinheit sauren wenig Wirkung auf die Fähigkeit von Glycinine in zu oligomerisieren Strukturen höherer Ordnung hatte. Wir entschieden uns, Alanin für unsere Mutationsanalyse basierend auf seiner Fähigkeit, in beiden toleriert werden &# X003b1; -Helix und &# X003b2; -Blatt Sekundärstruktur. Alle vier Ara h 3 Epitope befinden sich innerhalb der 35-kDa saure Untereinheit. Da es keine Überschneidungen zwischen den Aminosäuren betrachtet ist wichtig für die Glycinin Struktur (20) und die kritischen Reste, die für IgE-Bindung sind wir überzeugt, dass die Ara h 3 cDNA verändert werden kann, ein nonallergenic Protein zu kodieren, die seine native Struktur behält und Funktion. Dieses veränderte Gen kann verwendet werden, Erdnusspflanzen zu verändern, und das exprimierte Protein kann für die rekombinante Immuntherapie (38) verwendet werden.

Derzeit ist die einzige therapeutische Option für die Prävention von Lebensmitteln allergische Reaktionen Lebensmittel Vermeidung. Weil Erdnuss als Proteinergänzung in einer Vielzahl von verarbeiteten Nahrungsmitteln verwendet wird, ist ein versehentliches Verbrauch fast unvermeidlich (39). Rekombinante Allergene stellen viel versprechende Werkzeuge für die Diagnose und Behandlung von Nahrungsmittelüberempfindlichkeit Patienten. Eigenschaften von rekombinanten Allergene, die ihnen nützlich in einer klinischen Umgebung sind eine reduzierte Kapazität zu binden Serum IgE, um sicherzustellen, ein geringeres Risiko von IgE-vermittelten anaphylaktischen Nebenwirkungen und Beibehaltung ihrer T-Zell-Epitope, so dass Modulation der Immunantwort machen würde. Die Aufklärung der Haupt IgE-bindenden Epitope auf Ara h 3 und der Bestimmung, welche Aminosäuren innerhalb dieser Epitope kritisch sind für die IgE-Bindung enthält die erforderlichen Informationen der zu verändern Ara h 3 Gen durch ortsgerichtete Mutagenese ein Protein zu kodieren, das IgE Erkennungs entweicht. Aufgrund der umfangreichen Verwendung von Erdnussprotein in Verbraucher Lebensmittel und die mögliche Schwere einer Erdnuss-induzierten allergischen Reaktion sind unsere zukünftigen Studien mit dem Ziel einer cDNA zu erzeugen, die eine nonallergenic 11S Speicherprotein für beide immunotherapeutic Zwecke und stabile Transformation in Pflanzen kodiert zu produzieren eine hypoallergene Erdnuss.

Anerkennungen

Diese Arbeit wurde durch Gewährung RO1-AI33596 von der National Institutes of Health und von der Clarissa Sosin Allergy Research Foundation unterstützt.

Referenzen

1. Jansen JJ, et al. Die Prävalenz der Nahrungsmittelallergie und Intoleranz in der Erwachsenen-niederländischen Bevölkerung. J Allergy Clin Immunol. 1994; 93: 446-456. [PubMed]

2. Burks AW, Sampson HA. Lebensmittel-Allergien bei Kindern. Curr Prob Pediatr. 1993; 23: 230-252. [PubMed]

3. Sampson HA. Die Rolle der Nahrungsmittelallergie und Mediatorfreisetzung bei atopischer Dermatitis. J Allergy Clin Immunol. 1988; 81: 635-645. [PubMed]

4. James JM, Sampson HA. Eine Übersicht über Nahrungsmittelallergie. Pediatr Allergy Immunol. 1992; 3: 67-78.

5. Sutton BJ, Gould HJ. Das menschliche IgE-Netzwerk. Natur. 1993; 366: 421-428. [PubMed]

6. Arruda LK, vailes LD, Platts-Mills TAE, Hayden ML, Chapman MD. Induktion von IgE-Antikörperreaktionen durch Glutathion S -Transferase aus der Deutschen Schabe. J Biol Chem. 1997; 272: 20.907-20.912. [PubMed]

7. Akasawa A, Hsieh LS, Martin BM, Liu T, Lin Y. Eine neuartige saure Allergen Hev b 5, in Latex. J Biol Chem. 1996; 271: 25.389-25.393. [PubMed]

8. Gregoire C, et al. cDNA-Klonierung und Sequenzierung zeigen die großen Pferde Allergen Equ c1 ein Glykoprotein Mitglied der Lipocalin-Superfamilie zu sein. J Biol Chem. 1996; 271: 32.951-32.959. [PubMed]

9. Engel E, et al. Immunologische und biologischen Eigenschaften von Bet v 4, eine neuartige birch pollen allergen mit zwei EF-Hand-Calcium-bindenden Domänen. J Biol Chem. 1997; 272: 28.630-28.637. [PubMed]

10. Gibbs PEM, Strongin KB, McPherson A. Entwicklung von Leguminosenproteine ​​Samenspeicher&# X02014, eine Domäne gemeinsam Legumine und vicilins wird in vicilins dupliziert. Mol Biol Evol. 1989; 6: 614-623. [PubMed]

11. Broadbent JB, Sampson HA. Kreuzallergenität in der Leguminosen botanischen Familie bei Kindern mit Nahrungsmittelallergie. J Allergy Clin Immunol. 1989; 84: 701-709. [PubMed]

12. Eigenman PA, Burks AW, Bannon GA, Sampson HA. Identifizierung der einzigartigen Erdnuss und Soja-Allergene in Seren adsorbiert mit kreuzreagierenden Antikörper. J Allergy Clin Immunol. 1996; 98: 969-978. [PubMed]

13. Burks AW, Cockrell G, Stanley JS, Helm RM, Bannon GA. Rekombinante Erdnuss-Allergen Ara h 1-Expression und IgE-Bindung bei Patienten mit Erdnussallergie äussert. J Clin Invest. 1995; 96: 1715-1721. [PMC freie Artikel] [PubMed]

14. Stanley JS, et al. Identifizierung und Mutationsanalyse der immuno-IgE-bindenden Epitope des großen Erdnuss-Allergen Ara h 2 Arch Biochem Biophys. 1997; 342: 244-253. [PubMed]

15. Burks AW, et al. Mapping und Mutations-Analyse der IgE-bindenden Epitope auf Ara h 1, ein Leguminosen Vicilin Protein und einem Hauptallergen in Erdnussallergie äussert. Eur J Biochem. 1997; 245: 334-339. [PubMed]

16. Burks AW, et al. Die Identifizierung eines großen Erdnuss-Allergen Ara h 1, bei Patienten mit atopischer Dermatitis und positive Erdnuss Herausforderung. J Allergy Clin Immunol. 1991; 88: 172-179. [PubMed]

17. Sanger F, Nicklen S, Coulson AR. DNA-Sequenzierung mit Kettenabbruch-Inhibitoren. Proc Natl Acad Sci USA. 1977; 74: 5463-5467. [PMC freie Artikel] [PubMed]

18. Devereux J, Haeberli P, Smithies O. Eine umfassende Reihe von für die VAX-Analyseprogramme Sequenz. Nucleic Acids Res. 1984; 12: 387-395. [PMC freie Artikel] [PubMed]

19. Tobias JW, Shrader TE, Rocap G, Varshavsky A. Der N-Terminus-Regel in Bakterien. Wissenschaft. 1991; 254: 1374-1377. [PubMed]

20. Bairoch A, Bucher P. PROSITS: die jüngsten Entwicklungen. Nucleic Acids Res. 1994; 22: 3584-3589. [PMC freie Artikel] [PubMed]

21. Tumer NE, Richter JD, Nielsen NC. Die strukturelle Charakterisierung der Glycinin Vorstufen. J Biol Chem. 1982; 257: 4016-4018. [PubMed]

22. Barton KA, et al. Die Biosynthese und die Verarbeitung von hochmolekularen Vorstufen von Sojabohnen Glycinin-Untereinheiten. J Biol Chem. 1982; 257: 6089-6095. [PubMed]

23. Staswick PE, Hermodson MA, Nielsen NC. Identifizierung der sauren und basischen -Untereinheit Komplexe von Glycinin. J Biol Chem. 1981; 256: 8752-8755. [PubMed]

24. Staswick PE, Hermodson MA, Nielsen NC. Die Aminosäuresequenz der Untereinheit von A2B1a Glycinin. J Biol Chem. 1984; 259: 13.431-13.435. [PubMed]

25. Shin DS, et al. Biochemische und strukturelle Analyse der IgE-Bindungsstellen auf Ara h 1, und reichlich und sehr allergisch Erdnussprotein. J Biol Chem. 1998; 273: 13753-13759. [PubMed]

26. Astwood JD, Leach JN, Fuchs RL. Stabilität von Lebensmittelallergenen in vitro Verdauung. Nat Biotechnol. 1996; 14: 1269-1273. [PubMed]

27. Veiths, S. Aulepp, J. Becker, W. M. und Buschmann, L. 1996. Charakterisierung von labilen und stabilen Allergene in Lebensmitteln pflanzlichen Ursprungs. Im Nahrungsmittelallergien und Unverträglichkeiten. G. Eisenband, H. Aulepp, A. D. Dayan, P.S.Elias und W. Grunow, Editoren. VCH Verlagsgesellschaft. Weinheim, Deutschland. 130&# X02013; 149.

28. Nielsen, N. C. Scott, M. P. und Lago, W.J.P. 1990 Montageeigenschaften von modifizierten Untereinheiten in der Glycinins Untereinheit Familie. Im NATO Advanced Study Institute für Pflanzen Molekularbiologie. R. Hermann und B. Larkins, Editoren. Plenum Press. New York, NY. 635&# X02013; 640.

29. Kugel G, et al. Ein Haupt kontinuierliche Epitop von Rinder-Beta-Lactoglobulin durch menschliche IgE erkannt zu binden. Clin Exp Allergy. 1994; 24: 758-764. [PubMed]

30. Aas K, Elsayed S. physikalisch-chemischen Eigenschaften und spezifische Aktivität eines gereinigten Allergen (Dorsch) Dev Biol stehen. 1975; 29: 90-98. [PubMed]

31. Elsayed S, Holen E, Dybendal T. Synthetic allergene Epitope aus den Amino-terminalen Regionen der wichtigsten Allergene von Hasel und Birkenpollen. Int Arch Allergy Appl Immunol. 1989; 89: 410-415. [PubMed]

32. Herian AM, Taylor SL, Bush RK. Identifizierung von Soja Allergene durch mit Seren von Soja-Allergie Erwachsene Immunoblotting. Int Arch Allergy Appl Immunol. 1990; 92: 193-198. [PubMed]

33. Shanti KN, Martin BM, Nagpal S, Metcalfe DD, Rao PV. Identifizierung von Tropomyosin als Haupt Garnelen Allergen und Charakterisierung seiner IgE-bindenden Epitope. J Immunol. 1993; 151: 5354-5363. [PubMed]

34. Utsumi S, et al. Synthese, Verarbeitung und Akkumulation von modifiziertem Glycinine von Sojabohnen in den Samen, Blättern und Stengeln von transgenem Tabak. Plant Sci. 1993; 92: 191-202.

35. Utsumi S, Katsube T, Ishige T, Takaiwa F. Molecular Design von Sojabohnen Glycinine mit verbesserten Lebensmittelqualitäten und Entwicklung von Nutzpflanzen, Glycinine produzieren. Adv Exp Med Biol. 1997; 415: 1-15. [PubMed]

36. Dickinson CD, Scott MP, Hussein EH, Argos P, Nielsen NC. Wirkung von strukturellen Modifikationen an der Anordnung einer Glycinin Untereinheit. Pflanzenzelle. 1990; 2: 403-413. [PMC freie Artikel] [PubMed]

37. Lawrence MC, Izard T, Beuchat M, Blagrove RJ, Colman Uhr. Struktur des Phaseolins bei 2,2 A Auflösung. Implikationen für eine gemeinsame Vicilin / Legumins Struktur und der Gentechnik von Samenspeicherproteine. J Mol Biol. 1994; 238: 748-776. [PubMed]

38. Ferreira F, et al. Die Modulation der IgE-Reaktivität von Allergenen durch ortsgerichtete Mutagenese: mögliche Verwendung von hypoallergenen Varianten für die Immuntherapie. FASEB J. 1998; 12: 231-242. [PubMed]

39. Sicherer SH, Burks AW, Sampson HA. Klinische Symptome der akuten allergischen Reaktionen auf Erdnüsse und Baumnüsse bei Kindern. Pädiatrie. 1998; 102: 6-16. [PubMed]

Artikel aus dem Journal of Clinical Investigation sind hier zur Verfügung gestellt von American Society for Clinical Investigation

ZUSAMMENHÄNGENDE POSTS

  • Molekularer Ebene Antworten, Capsaicin-Creme Stärken.

    Formaldehyd ist, wo man es am wenigsten erwarten. Wenn Sie die meisten Leute fragen, ihre ersten Erfahrungen mit Formaldehyd entstanden in der High School Biologie. Vielleicht erinnern Sie sich biologische Proben ominös …

  • Molekularbiologie von Plattenepithelkarzinomen …

    Molekularbiologie von Plattenepithelkarzinomen des Kopfes und Halses B Perez # x02010; Ordo # x000f1; ez. Institut für Pathologie der Universität Health Network, und Department of Pathobiologie und …

  • Molecular Therapy, Lymphom-Systeme.

    Bewertung Citation: Molecular Therapy Nucleic Acids (2014) 3. E182; doi: 10.1038 / mtna.2014.32 Online veröffentlicht am 5. August 2014 Oligonucleotidaptamere: Neue Tools für die gezielte Krebstherapie Öffnen …

  • Molecular Therapy, sq Zellkrebs.

    Originaler Artikel Zitat: Molecular Therapy Nucleic Acids (2014) 3. E159; doi: 10.1038 / mtna.2014.9 Online 29. April 2014 Veröffentlicht Silencing VDAC1 Expression von siRNA hemmt …

  • Molecular Verfahren zum Nachweis …

    Molekulare Methoden zum Nachweis von Mycoplasma und Ureaplasma Infektionen bei Menschen Abstrakt Mycoplasma und Ureaplasma-Spezies sind bekannte menschliche Krankheitserreger verantwortlich für eine breite Palette von …

  • Molecular Diagnostics Trichomonas …

    Trichomonas Trichomonas vaginalis (T. vaginalis) ist ein einzelliger Krankheitserreger, der Trichomoniasis, eine sexuell übertragbare Krankheit, die hauptsächlich von Frauen verursacht. Trichomonas produziert Rindes mit …